Product Format
Genomic DNA Reference Standards are available in two formats:
Starter Packs
Contains one vial mutant (20ng) and one vial wild type (200ng). These can be used to generate stoichiometric dilutions (see dilutions matrix tab).
100ng Vial Packs
Contains one or more 100ng Mutant or Wild type vials with a defined allelic frequency. You can select the allelic frequency required and this is confirmed using Digital PCR.
Price per Vial
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
|
Starter Pack 20ng Mutant 200ng Wild type
|
$200 |
-- |
-- |
-- |
-- |
-- |
| 100ng Vial |
$300 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
$550 |
$750 |
-- |
-- |
-- |
$150 |
| 500ng Pack |
$800 |
$950 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
$1200 |
$1500 |
$1500 |
$1500 |
$1500 |
$375 |
Price per ng
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
| 100ng Vial |
$3 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
$2.75 |
$3.75 |
-- |
-- |
-- |
$0.75 |
| 500ng Pack |
$1.60 |
$1.90 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
$1.20 |
$1.50 |
$1.50 |
$1.50 |
$1.50 |
$0.38 |
Price per Vial
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
|
Starter Pack 20ng Mutant 200ng Wild type
|
£130 |
-- |
-- |
-- |
-- |
-- |
| 100ng Vial |
£195 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
£357.50 |
£487.50 |
-- |
-- |
-- |
£97.50 |
| 500ng Pack |
£520 |
£617.50 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
£780 |
£975 |
£975 |
£975 |
£975 |
£243.75 |
Price per ng
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
| 100ng Vial |
£1.95 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
£1.79 |
£2.44 |
-- |
-- |
-- |
£0.49 |
| 500ng Pack |
£1.04 |
£1.24 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
£0.78 |
£0.98 |
£0.98 |
£0.98 |
£0.98 |
£0.24 |
Price per Vial
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
|
Starter Pack 20ng Mutant 200ng Wild type
|
€150 |
-- |
-- |
-- |
-- |
-- |
| 100ng Vial |
€225 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
€412.50 |
€562.50 |
-- |
-- |
-- |
€112.50 |
| 500ng Pack |
€600 |
€712.50 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
€900 |
€1125 |
€1125 |
€1125 |
€1125 |
€281.25 |
Price per ng
| DNA Reference Standard | Allelic Frequency / Allele Burden |
50% Mutant | 20% Mutant | 10% Mutant | 5% Mutant | 1% Mutant | 0% Mutant (Wild type) |
| 100ng Vial |
€2.25 |
-- |
-- |
-- |
-- |
-- |
| 200ng Pack |
€2.06 |
€2.81 |
-- |
-- |
-- |
€0.56 |
| 500ng Pack |
€1.20 |
€1.43 |
-- |
-- |
-- |
-- |
| 1000ng Pack |
€0.90 |
€1.13 |
€1.13 |
€1.13 |
€1.13 |
€0.28 |
Please Note: Typically our mutant cell lines are heterozygous and have an allelic frequency of 50%. This information can be found on the genoytpe tab of each reference standard.
Background
Horizon Diagnostics genetically defined, genomic DNA extracts are mutant versus wild type reference standards. They contain defined ratios of mutant alleles and can be mixed in dilution series to validate the sensitivity and reproducibility of molecular assays. These standards are generated using Horizon Discovery's proprietary homologous recombination-driven precision genome editing platform GENESIS™.
Using GENESIS a normal (wild type) cell line is engineered to generate a new cell line harboring a specific mutation (insertion, deletion, point mutations,...). The new cell line is essentially identical to the original cell line apart from the encorporated mutation. Extracted genomic DNA from both cell lines can be used as Quantitative Molecular Reference Standards.
Please contact us if you have any questions: technical@horizondx.com
| | Mutant | Wild type |
| Genotype |
EGFR (G719S/+/+) |
EGFR (+/+) |
| Allelic Frequency |
33% EGFR G719S |
100% EGFR wild type |
| Cell Line |
SW48 |
RKO |
| Quantity |
20ng or 100ng per vial |
100ng or 200ng per vial |
| Concentration |
5 ng/µl |
5 ng/µl |
| |
|
| Buffer |
Tris EDTA (10mM Tris-HCl, 1mM EDTA), pH 8.0 |
| Storage Conditions |
+4°C |
| MSDS |
 |
Product Characterization
For Sanger sequencing we use the following primer set:
| Primer | Sequence | Size / bp |
| Forward |
GCTGAGGTGACCCTTGTCTC |
408 |
| Reverse |
GTCAATGGCCCCTTTCATAA |
| Sequencing |
GCTGAGGTGACCCTTGTCTC |
-- |
| Genotyping |
 |
| Chromatograph showing heterozygosity for the EGFR G719S mutation within EGFR (SNP accession number: rs28929495). |
| Quality |
 |
DNA was run on a 1% agarose gel and shows a single high-molecular weight band (Left).
Quantitative PCR of GAPDH shows equivalent EGFR (G719S/+) and EGFR (+/+) Ct values indicating the absence of PCR inhibitors (Right). |
Please contact us if you have any questions: technical@horizondx.com
This is the USD table
This is the GBP table
This is the euro table
Genomic DNA Starter Packs
These are provided with one mutant vial (20ng) and one wild type vial (200ng) at a concentration of 5ng/µl and can be used to generate allelic dilutions similar to:
| Allelic Frequency | Mutant (/µl) | Wild type (/µl) |
| 20% |
2 |
2 |
| 10% |
1 |
3.5 |
| 5% |
0.5 |
4.3 |
| 1% |
0.5 |
24.5 |
| 0% |
0 |
5 |
This matrix provides you with at least 20ng per allelic frequency.
100ng+ Vial Packs
To generate at least a 200ng diluted stock of the following allelic frequencies you will require the following mutant and wild type pack combinations:
| Allelic Frequency | Mutant 100ng Packs (Dilution) | Wild type 200ng Packs (Dilution) | Diluted Stock |
| 33% |
2 Packs (40µl) |
- |
200ng |
| 20% |
1 Pack (20µl) |
1 Pack (20µl) |
200ng |
| 10% |
1 Pack (10µl) |
1 Pack (35µl) |
225ng |
| 5% |
1 Pack (4.5µl) |
1 Pack (38.7µl) |
216ng |
| 1% |
1 Pack (0.8µl) |
1 Pack (39.2µl) |
200ng |
| 0% |
- |
1 Pack (40µl) |
200ng |
Please contact us if you have any questions: technical@horizondx.com
Quality Control Summary
The following tests are run as standard to ensure the quality of our quantitative molecular reference standards:
| Test | Method |
| Allelic Frequency |
Droplet Digital PCR™ |
| Cell line ID |
Microsatellite profiling of source cell line |
| Genotype |
Sanger sequencing of locus specific PCR |
| Quality |
Agarose gel electrophoresis, Quantitatitive PCR of GAPDH locus |
| Quantification |
Quantifluor™ assay |
Please contact us if you have any questions: technical@horizondx.com